Skip to main content
Download PDF

Genetic diversity of Plasmodium falciparum in Grande Comore Island

Malaria Journal volume 19, Article number: 320 (2020) Cite this article

Abstract

Background

Despite several control interventions resulting in a considerable decrease in malaria prevalence in the Union of the Comoros, the disease remains a public health problem with high transmission in Grande Comore compared to neighbouring islands. In this country, only a few studies investigating the genetic diversity of Plasmodium falciparum have been performed so far. For this reason, this study aims to examine the genetic diversity of P. falciparum by studying samples collected in Grande Comore in 2012 and 2013, using merozoite surface protein 1 (msp1), merozoite surface protein 2 (msp2) and single nucleotide polymorphism (SNP) genetic markers.

Methods

A total of 162 positive rapid diagnostic test (RDT) samples from Grande Comore were used to extract parasite DNA. Allelic families K1, Mad20 and RO33 of the msp1 gene as well as allelic families IC3D7 and FC37 of the msp2 gene were determined by using nested PCR. Additionally, 50 out of 151 samples were genotyped to study 24 SNPs by using high resolution melting (HRM).

Results

Two allelic families were predominant, the K1 family of msp1 gene (55%) and the FC27 family of msp2 gene (47.4%). Among 50 samples genotyped for 24 SNPs, 42 (84%) yielded interpretable results. Out of these isolates, 36 (85%) were genetically unique and 6 (15%) grouped into two clusters. The genetic diversity of P. falciparum calculated from msp1 and msp2 genes and SNPs was 0.82 and 0.61, respectively.

Conclusion

In summary, a large genetic diversity of P. falciparum was observed in Grande Comore. This may favour persistence of malaria and might be one of the reasons for the high malaria transmission compared to neighbouring islands. Further surveillance of P. falciparum isolates, mainly through environmental management and vector control, is warranted until complete elimination is attained.

Background

Despite several interventions to prevent, control, and eliminate malaria, 219 million cases and 435,000 deaths occurred worldwide in 2018, mainly in children under 5 years and pregnant women in Africa [1]. Plasmodium falciparum remains the most dominant species in Africa and responsible for the most severe clinical forms; it is associated with 95% of malaria-associated deaths [2, 3]. Many factors contribute to the severity of P. falciparum infections, such as the level of acquired immunity of the individual and genetic characteristics of the parasite [4].

The genetic diversity of P. falciparum remains an obstacle to achieve malaria elimination. Previous vaccine trials have shown limited efficacy of interventions in time and different geographic regions due to genetic polymorphisms [5, 6]. The genes coding for merozoite surface protein-1 (MSP1) and merozoite surface protein-2 (MSP2) have been widely used as genetic markers to determine allelic polymorphisms of P. falciparum [7,8,9]. The genome of P. falciparum is characterized by substitutions of single nucleotides occurring at specific positions in the genome, referred to as single nucleotide polymorphisms (SNPs). Approximately 112,000 SNPs have been described in the genome of P. falciparum and are considered useful molecular markers for barcoding to identify and characterize genetic diversity of P. falciparum [10,11,12].

In the Comoros archipelago, which is composed of four islands in the Indian Ocean between Madagascar and the African coast, malaria remains a major public health problem with high transmission and mortality rate among children under five years old [2]. Since 2004, Comoros has dramatically increased deployment of intervention strategies, including insecticide-treated bed nets, the treatment of patients with artemisinin-based combination therapy and the introduction of intermittent preventive treatment (IPT) in pregnant women. These strategies have resulted in a significant decrease in malaria infection, from 54,078 cases in 2004 to 1,072 in 2015 [13]. However, extensive interventions against malaria might as well result in changes in the population structure of Plasmodium species. First, because high genetic diversity has been associated with high levels of malaria transmission [14], a measure of genetic diversity can provide an indirect assessment of the effectiveness of an intervention [15]. Second, a high genetic structure of parasite populations, observable when gene flows between populations remain limited, allows for localized interventions. Conversely, the absence of population structure imposes the need for larger-scale strategies to be effective in the long term. Consequently, an estimation of genetic diversity in local P. falciparum isolates can provide important information on how to improve strategies to reach malaria elimination.

A 2010 study revealed a significant diversity of P. falciparum strains in the Union of Comoros where the mean expected heterozygosity (He) was 0.63 in Grande Comore and the multiplicity of infection (MOI) was 1.39 from microsatellite data [16]. Since this study, only one study has been conducted to investigate genetic diversity of the parasite in Comoros [17]. The results of this latter study showed a decrease in genetic diversity and in MOI based on msp genes correlated with a decrease in malaria transmission in Grande Comore.

As a follow-up of that study, the aim of the present study was to characterize P. falciparum populations in other sites in Grande Comore using msp1, msp2 and SNPs to determine the genetic diversity and MOI.

Methods

Study site

A total of 162 rapid diagnostic tests (RDTs) were collected in 2012 and 2013 in three sites of Grande Comore (Moroni n = 26, Mitsamiouli n = 59, and Mbeni n = 77). Malaria transmission varies in these three sites: hypoendemic in Moroni, mesoendemic in Mitsamiouli, and hyperendemic in Mbeni [16] (Fig. 1). The following RDTs were used in Grande Comore at the time of the present study: CareStart™ Malaria HRP2/pLDH Combo RDT (Access Bio, Inc., Somerset, NJ) and Standard Diagnostics Bioline Malaria Ag Pf/Pan test (SD Bioline/Abbott, Yongin-si, Gyeonggi-do, Republic of Korea). RDTs that were positive for P. falciparum were collected from health centres. RDTs that were negative or invalid were excluded from this study. All RDTs were stored at room temperature until they were used for DNA extraction.

Fig. 1
figure 1

Map of Grande Comore Island showing the study sites

Full size image

DNA extraction

Parasite DNA stored on the nitrocellulose membrane of RDTs was extracted according to the protocol developed by Cnops et al. [18]. DNA extraction was performed using QIAmp DNA or Blood Mini kit (Qiagen, Germantown, MD) following the manufacturer’s instructions.

Genotyping of msp1 and msp2

Msp1 and msp2 genes were amplified by nested PCR as described in earlier studies [19, 20]. All PCR amplifications were carried out in a total volume of 20 μl containing 6 μl Gotaq® DNA polymerase-reaction buffer (Promega Corporation; Madison, WI), 0.5 μM of each primer, and 11 μl reagent grade water. The cycling conditions for the primary PCR were as follows: initial denaturation at 95 °C for 5 min, followed by 35 cycles of 94 °C for 1 min, 58 °C for 2 min, 72 °C for 2 min, with a final extension cycle of 72 °C for 3 min. The cycling conditions for the nested PCR were as follows: initial denaturation at 95 °C for 5 min, followed by 35 cycles of 94 °C for 1 min, 61 °C for 2 min, 72 °C for 2 min, with a final extension cycle of 72 °C for 3 min. Positive controls and negative control were run in each PCR. PCR products were analysed by gel electrophoresis on 2% agarose gels and visualized under ultraviolet trans-illumination (Biorad Gel Doc™ XR + System with Image Lab). A 100 bp DNA ladder (Quick-Load) was used to determine the size of PCR products.

The expected sizes of PCR products for the msp1 gene were between 150–300 bp, 130–230 bp, and 150–200 bp for K1, MAD, and RO33, respectively. For the msp2 gene, the expected sizes were between 290–450 bp for FC27 and between 450–700 bp for IC3D7.

Genotyping of SNPs

Twenty-four SNPs of P. falciparum were genotyped by using high-resolution melting (HRM), as previously described [21]. PCR amplifications were performed using 2.5 × Light Scanner master mix (Biofire Diagnostics, Inc., Salt Lake City, UT), with forward primers at a final concentration of 0.05 μM, reverse primers at a final concentration of 0.2 μM, and allele-specific probes at a final concentration of 0.2 μM, and 1 μl of genomic DNA. SNPs were identified with a high minor allele frequency. The cycling and melting conditions for SNPs were as follows: 95 °C denaturation for 2 min followed by 55 cycles of 95 °C for 5 s and 56 °C for 30 s, then a pre-fusion cycle of 5 s each at 95 °C and 37 °C, followed by a melt from 35 °C to 90 °C at 0.30 °C/s.

Statistical analysis

Genetic diversity of msp1 and msp2 genes of the 3 populations (Moroni, Mitsamiouli, and Mbeni) was determined by the number of alleles per locus and by Nei [22] unbiased expected heterozygosity index (He) using GENETIX software version 4.05 [23].

$$He=\left(\frac{2n-1}{2n}\right)\left(1-\sum_{i}{x}_{i}^{2}\right)$$

where n is the sample size and \({x}_{i}\) is the frequency of i allele.

Genetic diversity index based on SNPs, equivalent to the expected heterozygosity index (He), was estimated by \(\pi\) diversity index [24], implemented with MEGA X version 10.1 [25]. Phylogenetic tree, based on SNPs data, was constructed using MEGA X unweighted pair group method with arithmetic mean (UPGMA) algorithm [26].

Fisher’s exact test was used to compare the allelic frequencies of msp1 and msp2 genes in three regions of the Grande Comore and He. The MOI is the mean number of fragments detected for each msp gene and each allelic family. A sample with one clone for the msp genes was considered monoclonal, while a sample with at least 2 clones was considered polyclonal. Mann–Whitney U test was used to compare mean MOI. The significance threshold was fixed at α = 0.05.

Results

Genotyping of msp1 and msp2

Of 162 samples, 151 were successfully genotyped: 25 from Moroni, 49 from Mitsamiouli, and 77 from Mbeni. Among them, 21 individual alleles were found, including 12 alleles for msp1 gene and 9 alleles for msp2 gene.

For msp1, 7 K1 type alleles (150–300 bp), 3 MAD20 type alleles (190–230 bp), and 2 RO33 type alleles (150 and 200 bp) were observed (Fig. 2). The most frequent K1, RO33, and MAD20 type alleles were 200 bp (60/132), 150 bp (17/18), and 200 bp (34/64) fragments, respectively. For msp2, 3 FC27 type alleles (350–450 bp) and 6 IC3D7 type alleles (450–700 bp) were obtained. For FC27, the most frequent type allele was 400 bp fragment, and the most frequent type allele for IC3D7 was 500 bp fragment (Fig. 3).

Fig. 2
figure 2

The numbers of occurrence of alleles for each msp1 allelic family K1 (blue), MAD20 (red), and RO33 (black) are shown in the figure. The total numbers of K1, MAD20, and RO33 alleles are 134, 64 and 18, respectively

Full size image
Fig. 3
figure 3

The numbers of occurrence of alleles for each msp2 allelic family FC27 (red) and IC3D7 (gray) are shown in the figure. The total numbers of FC27 and IC3D7 alleles are 84 and 73, respectively

Full size image

In all three sites, the K1 family was predominant (55%) for msp1 gene (Table 1). It was more frequent in Mbeni (71.1%) compared to Moroni (50%; p = 0.059) and Mitsamiouli (30.6%; p < 0.01) (Fig. 4). There was no significant difference of K1 frequency between Moroni and Mitsamiouli (p > 0.05). However, MAD20 msp1 allelic family was more frequently observed in Mitsamiouli (22.4%) than in Moroni (19.2%; p = 1) or Mbeni (9.6%; p = 0.29). RO33 msp1 allelic family was poorly represented (2.4–4.0%) in all three sites.

Table 1 Genetic diversity of P. falciparum msp genes in Grande Comore
Full size table
Fig. 4
figure 4

Allelic frequencies of msp1 and msp2 genes in 3 sites of Grande Comore

Full size image

For msp2 gene, IC3D7 allelic family was predominant in Moroni (65%). Its frequency was lower in both Mitsamiouli (39%; p = 0.80) and Mbeni (31.6%; p = 0.36). The FC27 family was found to be predominant in Mbeni (60.5%), in comparison to Moroni (20%; p < 0.01) and Mitsamiouli (36%; p = 0.019).

In Moroni, a total of 10 (40%) samples showed polyclonal infection with at least two clones, resulting in mean MOI of 1.40 (Table 2). In Mitsamiouli, 26 (53%) samples showed polyclonal infections with at least two clones (MOI = 1.57) and in Mbeni 26 (33.8%) samples were polyclonal (MOI = 1.35). There was no significant difference in MOI between Moroni and Mitsamiouli (p = 0.30). In Mbeni, 26 (33.8%) samples were polyclonal, and mean MOI was 1.35. The difference in MOI was not statistically significant between Mbeni and Mitsamiouli (p = 0.06) and between Moroni and Mbeni (p = 0.67).

Table 2 Multiplicity of infection (MOI) based on msp1 and msp2 genes in P. falciparum isolates from Moroni, Mitsamiouli, and Mbeni
Full size table

Genotyping of SNPs

In this study, 50 of 151 (33%) samples were genotyped for 24 SNP markers. Among these, 42 samples (1 from Moroni, 17 from Mitsamiouli, and 24 from Mbeni) and 21 SNPs yielded interpretable results (Additional file 1: Table S1). These 42 samples were used for analysis by SNPs. Considering the similar level of genetic diversity included in this sub-sample (He = 0.82) and in all 151 samples (He = 0.83) based on msp genes, the representativeness of our sub-sample was confirmed.

Overall, 36 of 42 (85.7%) different genotypes were obtained from 42 samples. Six of 42 (14.3%) isolates grouped into two clusters, defined as a group of parasites with identical SNP barcode: one cluster consisting of 2/42 (4.8%) parasite populations from Mitsamiouli (defined by the barcode TACCXCGACXTAATAAGAXGG; “X” denotes an absence of amplification) and another cluster consisting of 4/42 (9.5%) samples from Mbeni (defined by the barcode TATTCCGTTGCCACTCGATTG). Moreover, among 36 genetically unique isolates, several had a strong linkage since they only differed from each other by a few nucleotides (Additional file 2: Figure S1).

To investigate whether there is an association between barcode and msp1 and/or msp2 (clonality), SNPs (clusters and unique barcodes) were classified as monoclonal or polyclonal. Analysis showed that all clusters were polyclonal. Among the parasites with unique barcodes, 7 of 36 (19.4%) were monoclonal, and 29 of 36 (80.6%) were polyclonal.

Allelic frequency

Data on allelic frequency showed that several nucleotides predominated at the study sites. At P2 position, adenine (A) number predominated at all sites. At P5 position, cytosine (C) number predominated. At positions P21 and P24, adenine (A) and guanine (G) numbers were seen in the majority of isolates collected in Mitsamiouli and Moroni, respectively. The lowest minority allelic frequency (MAF) was found in position 20 in 5 of 42 (11.9%) isolates calculated from guanine number (Additional file 1: Table S1).

Genetic diversity

Genetic diversity (He) was estimated from msp and SNPs. For msp genes, the highest mean diversity was observed in Moroni and Mitsamiouli (He = 0.84 in both sites) (Table 3). There was no significant difference between Moroni and Mbeni (p = 0.48). The mean genetic diversity for all sites was 0.83 (Table 3). For SNPs, He was determined at Mitsamiouli and Mbeni. The highest genetic diversity was found at Mitsamiouli (He = 1) and the lowest at Mbeni (He = 0.41).

Table 3 Genetic diversity of P. falciparum at 3 sites in Grande Comore
Full size table

In addition, He values based on msp and SNP were compared in both sites using Fisher's exact test. The He index based on msp gene was higher than the index based on SNP in Mbeni (p < 0.01), but an opposite but insignificant trend was observed in Mitsamouili (p = 0.08). Comparison in the whole populations did not show any difference (p = 0.9) (Table 4).

Table 4 Comparison of genetic diversity using msp and SNPs
Full size table

Discussion

The Union of Comoros has entered the phase of malaria elimination after the implementation of several strategies, such as the massive use of insecticide-impregnated bed nets (ITNs), artemisinin-based combination therapy (ACT) for confirmed malaria cases, intermittent preventive treatment in pregnant women (IPTp), and mass drug administration (MDA) with artesunate-mefloquine and primaquine. However, the impact of this intervention on genetic diversity in P. falciparum has so far received limited attention and needs to be further investigated. In Grande Comore, genotyping of msp1 and msp2 genes revealed a high allelic polymorphism (He = 0.83), comparable to areas of high malaria transmission in Africa [27,28,29]. For 12 alleles in the msp1 gene, the K1 family was dominant (55%). For 9 alleles in the msp2 gene, the FC27 family was most represented (47.4%). These results are similar to those obtained in Madagascar [30] and in Grande Comore in isolates collected in 2013–2016 [17]. Interestingly, the results of the present study differ from those observed in Grande Comore in isolates collected in 2006–2007, in which RO33 family was predominant [17].

Fragment analysis of msp1 and msp2 allelic families using agarose gel electrophoresis used in the present study has limitations due to difficulties in defining specific alleles with accuracy for each isolate. To circumvent this drawback, 24 SNPs were used to determine the genetic diversity of P. falciparum in Grande Comore for the first time. These 24 SNPs are able to identify different parasites with a high minor allelic frequency [21]. After SNP genotyping, it was found that 85% of isolates are genetically unique. These results suggest that there is a high level of genetic diversity of P. falciparum on the island (He = 0.61). The results of SNP genotyping confirm those of msp1 and msp2 markers (He = 0.82, p = 0.9).

The comparison of results from the studies concerning msp and barcode showed that all clusters were polyclonal. Similarly, among isolates with unique barcodes, the majority (78.9%) were polyclonal as well although data obtained in the present study suggested that the barcode of 21 SNPs cannot predict mixed infections. MOI based on msp remains the most powerful tool for determining the number of distinct P. falciparum populations in an infection. The average MOI found in this study for all sites was 1.36 for msp1 and 1.05 for msp2. These results are similar to those obtained in Grande Comore in isolates collected in 2013–2016, suggesting a decreasing malaria transmission intensity on this island [17]. Moreover, the present study confirmed the decrease in genetic diversity observed by Huang et al. (He = 0.95 before intervention; He = 0.84 after intervention against malaria) [17]. However, comparison of the results of this study with those of Rebaudet et al. (He = 0.63 calculated from microsatellite markers) [16] showed discordance in the level of genetic diversity of P. falciparum. This may be due to the choice of msp markers used, which are biased due to immune pressure.

Moreover, the considerable level of genetic diversity was found in this study despite trends in decreased malaria transmission in Comoros. Indeed, it has been established that a high genetic diversity of P. falciparum is more frequent in areas of high transmission [14]. This observation may provide an explanation for malaria persistence in Grand Comore compared to neighboring islands, despite application of strategies to eliminate malaria, such as MDA. This hypothesis is supported by the fact that Grande Comore alone, compared to three other islands in the Union of Comoros, accounted for 99.4% of malaria cases in 2014 [31]. Indeed, in Grande Comore, there are a large number of water cisterns and ablution basins which serve as mosquito breeding sites [2]. Therefore, local vector control interventions, including larval control, may be needed to improve malaria control.

Conclusion

Clinical isolates of P. falciparum showed high genetic diversity in Grande Comore. This might be one of the reasons for the high malaria transmission in this island, in comparison to neighbouring islands, despite the implementation of several malaria elimination strategies. Further studies on genetic diversity are essential to determine the impact of past interventions. Additionally, they may contribute to the adoption of future strategies for the achievement of malaria elimination in the Union of the Comoros.

Availability of data and materials

All data generated or analysed during this study are included in this article and are available from the corresponding author.

Abbreviations

ACT:

Artemisinin-based combination therapy

HRM:

High-resolution melting

IPTp:

Intermittent preventive treatment in pregnant women

ITNs:

Insecticide-impregnated bed nets

MDA:

Mass drug administration

MOI:

Multiplicity of infection

msp1:

Merozoite surface protein-1

msp2:

Merozoite surface protein-2

RDT:

Rapid diagnostic test

SNP:

Single nucleotide polymorphisms

UPGMA:

Unweighted pair group method with arithmetic mean

References

  1. WHO. World Malaria Report. Geneva: World Health Organization; 2018.

  2. Ouledi A. Epidemiology and control of malaria in the Federal Islamic Republic of Comoros (in French). Santé. 1995;5:368–71.

    CAS  PubMed  Google Scholar 

  3. Papa Mze N, Ahouidi AD, Diedhiou CK, Silai R, Diallo M, Ndiaye D, et al. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests. Parasite. 2016;23:34.

    Article  Google Scholar 

  4. Ringwald P, Peyron F, Lepers JP, Rabarison P, Rakotomalala C, Razanamparany M, et al. Parasite virulence factors during falciparum malaria: rosetting, cytoadherence, and modulation of cytoadherence by cytokines. Infect Immun. 1993;61:5198–204.

    Article  CAS  Google Scholar 

  5. Neafsey DE, Juraska M, Bedford T, Benkeser D, Valim C, Griggs A, et al. Genetic diversity and protective efficacy of the RTS, S/AS01 malaria vaccine. N Engl J Med. 2015;273:21.

    Google Scholar 

  6. Zeeshan M, Alam MT, Vinayak S, Bora H, Tyagi RK, Alam MS, et al. Genetic variation in the Plasmodium falciparum circumsporozoite protein in India and its relevance to RTS. S malaria vaccine PLoS One. 2012;7:8.

    Google Scholar 

  7. Viriyakosol SSN, Petcharapirat C, Petcharapirat P, Jarra W, Thaithong S, Brown KN, et al. Genotyping of Plasmodium falciparum isolates by the polymerase chain reaction and potential uses in epidemiological studies. Bull World Health Organ. 1995;73:85–95.

    CAS  PubMed  PubMed Central  Google Scholar 

  8. Conway DJ. Natural selection on polymorphic malaria antigens and the search for a vaccine. Parasitol Today. 1997;13:26–9.

    Article  CAS  Google Scholar 

  9. Bouyou-Akotet MK, M'Bondoukwe NP, Mawili-Mboumba DP. Genetic polymorphism of merozoite surface protein-1 in Plasmodium falciparum isolates from patients with mild to severe malaria in Libreville. Gabon Parasite. 2015;22:12.

    Article  Google Scholar 

  10. Mu J, Awadalla P, Duan J, McGee KM, Keebler J, Seydel K, et al. Genome-wide variation and identification of vaccine targets in the Plasmodium falciparum genome. Nat Genet. 2007;39:126–30.

    Article  CAS  Google Scholar 

  11. Jeffares DC, Pain A, Berry A, Cox AV, Stalker J, Ingle CE, et al. Genome variation and evolution of the malaria parasite Plasmodium falciparum. Nat Genet. 2007;39:120–5.

    Article  CAS  Google Scholar 

  12. Volkman SK, Sabeti PC, DeCaprio D, Neafsey DE, Schaffner SF, Milner DA Jr, et al. A genomewide map of diversity in Plasmodium falciparum. Nat Genet. 2007;39:113–9.

    Article  CAS  Google Scholar 

  13. Toyb M, Ouledi A, Gaüzère BA, Aubry P. [Malaria in the Comoros Archipelago in 2015: status after 15 years of fight] (in French) Bull Soc Pathol Exot. 2016;109:107–13.

  14. Anderson TJ, Haubold B, Williams JT, Estrada-Franco JG, Richardson L, Mollinedo R, et al. Microsatellite markers reveal a spectrum of population structures in the malaria parasite Plasmodium falciparum. Mol Biol Evol. 2000;17:1467–82.

    Article  CAS  Google Scholar 

  15. Daniels R, Chang HH, Sene PD, Park DC, Neafsey DE, Schaffner SF, et al. Genetic surveillance detects both clonal and epidemic transmission of malaria following enhanced intervention in Senegal. PLoS ONE. 2013;8:e60780.

    Article  CAS  Google Scholar 

  16. Rebaudet S, Bogreau H, Silaï R, Lepere JF, Bertaux L, Pradines B, et al. Genetic structure of Plasmodium falciparum and elimination of malaria. Comoros Archipelago Emerg Infect Dis. 2010;16:1686–94.

    Article  Google Scholar 

  17. Huang B, Tuo F, Liang Y, Wu W, Wu G, Huang S, et al. Temporal changes in genetic diversity of msp-1, msp-2, and msp-3 in Plasmodium falciparum isolates from Grande Comore Island after introduction of ACT. Malar J. 2018;17:83.

    Article  Google Scholar 

  18. Cnops L, Boderie M, Gillet P, Van Esbroeck M, Jacobs J. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR. Malar J. 2011;10:67.

    Article  CAS  Google Scholar 

  19. Snounou G, Zhu X, Spiripoon N, Jarra W, Thaithong S, Brown KN, et al. Biased distribution of msp1 and msp2 allelic variant in Plasmodium falciparum populations in Thailand. Trans R Soc Trop Med Hyg. 1999;93:369–74.

    Article  CAS  Google Scholar 

  20. Papa Mze N, Ndiaye YD, Diedhiou CK, Rahamatou S, Dieye B, Daniels R, et al. RDTs as a source of DNA to study Plasmodium falciparum drug resistance in isolates from Senegal and the Comoros Islands. Malar J. 2015;14:373.

    Article  Google Scholar 

  21. Daniels R, Volkman K, Milner DA, Mahesh N. A general SNP-based molecular barcode for Plasmodium falciparum identification and tracking. Malar J. 2008;7:223.

    Article  Google Scholar 

  22. Nei M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics. 1978;89:583–90.

    CAS  PubMed  PubMed Central  Google Scholar 

  23. Belkhir K, Borsa P, Chikhi L, Raufaste L, Bonhomme F. GENETIX 4.05, Windows software for population genetics (author’s translation). Montpellier, France: Laboratoire Génome, Populations, Interactions, CNRS UMR 5000, Université de Montpellier II; 1996–2004. http://www.genetix.univ-montp2.fr/genetix/genetix.htm. Accessed 27 Jun 2020 (in French).

  24. Nei M, Li WH. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc Natl Acad Sci USA. 1979;10:5269–73.

    Article  Google Scholar 

  25. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35:1547–9.

    Article  CAS  Google Scholar 

  26. Sokal RR, Michener CD. A statistical method for evaluating systematic relationships. Univ Kans Sci Bull. 1958;38:1409–38.

    Google Scholar 

  27. Funwei RI, Thomas BN, Falade CO, Ojurongbe O. Extensive diversity in the allelic frequency of Plasmodium falciparum merozoite surface proteins and glutamate-rich protein in rural and urban settings of southwestern Nigeria. Malar J. 2018;17:1.

    Article  Google Scholar 

  28. Mohammed H, Kassa M, Mekete K, Assefa A, Taye G, Commons RJ. Genetic diversity of the msp-1, msp-2, and glurp genes of Plasmodium falciparum isolates in Northwest Ethiopia. Malar J. 2018;17:1.

    Article  Google Scholar 

  29. Singana BP, Mayengue PI, Niama RF, Ndounga M. Genetic diversity of Plasmodium falciparum infection among children with uncomplicated malaria living in Pointe-Noire, Republic of Congo. Pan Afr Med J. 2019;32:183.

    PubMed  PubMed Central  Google Scholar 

  30. Sallenave-Sales S, Daubersies P, Mercereau-Puijalon O, Rahimalala L, Contamin H, Druilhe P, et al. Plasmodium falciparum: a comparative analysis of the genetic diversity in malaria-mesoendemic areas of Brazil and Madagascar. Parasitol Res. 2000;86:692–8.

    Article  CAS  Google Scholar 

  31. Programme National de Lutte contre le Paludisme (PNLP) aux Comores. Rapport 2014, p. 5.

Download references

Acknowledgements

We thank Mohamed Abdou Said Fazul, Miradji Maamoune, and Mbaye Toyb for sample collection in Comores. We also thank Baba Dieye and Sembene Mbacke for critical reading of the manuscript and Rachel F. Daniels for analysis of results.

Funding

Not applicable.

Author information

Authors and Affiliations

  1. Laboratory of Bacteriology-Virology, Hospital Aristide Le Dantec, BP 7325, Dakar, Senegal

    Nasserdine Papa Mze, Cyrille K. Diedhiou, Amy K. Bei, Souleymane Mboup & Ambroise D. Ahouidi

  2. Institut de Recherche en Santé, de Surveillance Épidémiologique et de Formations, Arrondissement 4 Rue 2D1 Pôle Urbain de Diamniadio, Dakar, Senegal

    Nasserdine Papa Mze, Cyrille K. Diedhiou, Souleymane Mboup & Ambroise D. Ahouidi

  3. Aix Marseille Univ, IRD, AP-HM, SSA, VITROME, Marseille, France

    Nasserdine Papa Mze, Hervé Bogreau & Leonardo Basco

  4. IHU-Méditerranée Infection, Marseille, France

    Nasserdine Papa Mze, Hervé Bogreau & Leonardo Basco

  5. Laboratory of National Malaria Control Program, Moroni, Comoros

    Nasserdine Papa Mze & Silai Rahamatou

  6. Département Microbiologie et Maladies Infectieuses, Institut de Recherche Biomédicale des Armées, Unité Parasitologie et Entomologie, Marseille, France

    Hervé Bogreau

  7. Centre National de Référence du Paludisme, Marseille, France

    Hervé Bogreau

  8. Karolinska Institutet, Berzelius väg 3, 17177, Stockholm, Sweden

    Vendela Herdell

  9. Department of Epidemiology of Microbial Diseases, Yale School of Public Health, New Haven, CT, 06510, USA

    Amy K. Bei

  10. Broad Institute: The Broad Institute of MIT and Harvard, Cambridge, MA, 02142, USA

    Sarah K. Volkman

Authors
  1. Nasserdine Papa Mze
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Hervé Bogreau
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Cyrille K. Diedhiou
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Vendela Herdell
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Silai Rahamatou
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Amy K. Bei
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Sarah K. Volkman
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Leonardo Basco
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Souleymane Mboup
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Ambroise D. Ahouidi
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

NPM performed experiments and wrote the manuscript. ADA and SKV conceived and designed the study. HB analysed, edited, and reviewed the manuscript. SR contributed the materials and analysis tools and offered experimental advice. CKD, AKB, and LB contributed to data analysis and reviewed the manuscript. LB, ADA, and SM supervised the research, wrote, read, and improved the final manuscript. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Nasserdine Papa Mze or Ambroise D. Ahouidi.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Additional file 1: Table S1.

Molecular barcodes for sequenced P. falciparum isolates. Reference P. falciparum clones 3D7/unknown origin (airport malaria, The Netherlands), Dd2/Indochina, HB3/Honduras, and Tm90/Thailand were controls used to differentiate parasite genotypes. MAF, minority allelic frequency. N denotes the number of mixed alleles. X denotes missing nucleotide data. The frequency of minority alleles was determined by counting the number of minority allele in each position.

Additional file 2: Figure S1.

Phylogenetic tree of SNPs. Samples C13 and C34 are from Mitsamiouli and had the same nucleotide sequence. Samples C54, C48, C44, and C41 had the same sequence. They were all collected in Mbeni. Several isolates were strongly linked. For example, C22 and C24 had a single nucleotide difference. Phylogenetic tree based on SNPs data was constructed using MEGA X UPGMA algorithm.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Papa Mze, N., Bogreau, H., Diedhiou, C.K. et al. Genetic diversity of Plasmodium falciparum in Grande Comore Island. Malar J 19, 320 (2020). https://0-doi-org.brum.beds.ac.uk/10.1186/s12936-020-03384-5

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12936-020-03384-5

Keywords

Malaria Journal

ISSN: 1475-2875

Contact us