Skip to main content

Allelic diversity of merozoite surface protein genes (msp1 and msp2) and clinical manifestations of Plasmodium falciparum malaria cases in Aceh, Indonesia

Abstract

Background

The malaria control programme in Indonesia has successfully brought down malaria incidence in many parts in Indonesia, including Aceh Province. Clinical manifestation of reported malaria cases in Aceh varied widely from asymptomatic, mild uncomplicated to severe and fatal complications. The present study aims to explore the allelic diversity of merozoite surface protein 1 gene (msp1) and msp2 among the Plasmodium falciparum isolates in Aceh Province and to determine their potential correlation with the severity of malaria clinical manifestation.

Methods

Screening of over 500 malaria cases admitted to the hospitals in 11 districts hospital within Aceh Province during 2013–2015, identified 90 cases of P. falciparum mono-infection without any co-morbidity. The subjects were clinically phenotyped and parasite DNA was extracted and polymerase chain reaction (PCR) amplified for the msp1 and msp2 allelic subfamilies.

Results

Analysis of clinical manifestation revealed that fever-chill is the most frequent symptom. Based on WHO criteria showed 19 cases were classified as severe and 71 as mild malaria. Analysis of msp1 gene revealed the presence of K1 allele subfamily in 34 subjects, MAD20 in 42 subjects, RO33 in 1 subject, and mixed allelic of K1 + MAD20 in 5 subjects, K1 + RO33 in 4 subjects, and MAD20 + RO33 in 4 subjects. Analysis of msp2 gene revealed 34 subjects carried the FC27 allelic subfamily, 37 subjects carried the 3D7 and 19 subjects carried the mixed FC27 + 3D7. Analysis of multiplicity of infection revealed that msp1 alleles is slightly higher than msp2 with the mean of MOI were 2.69 and 2.27, respectively. Statistical analysis to determine the association between each clinical manifestation and msp1 and msp2 alleles revealed that liver function abnormal value was associated with the msp2 mixed alleles (odds ratio (OR):0.13; 95%CI: 0.03–0.53). Mixed msp1 of K1 + RO33 was associated with severe malaria (OR: 28.50; 95%CI: 1.59–1532.30).

Conclusion

This study found a strong association between severe malaria in Aceh with subjects carrying the msp1 mixed alleles of K1 and RO33. The liver function abnormal value associated with the msp2 mixed allelic subfamilies. Further study in different geographic areas is recommended.

Background

Malaria remains a major public health problem in Indonesia despite a success in bringing down the incidence within the last few decades. Since the implementation of the malaria elimination programme in 2009, the malaria cases in Indonesia dropped significantly from 418,439 to 261,617 and the vast majority of the cases occurred in 5 provinces of the eastern parts of country [1]. In Aceh Province, effective monitoring of the implementation of malaria elimination programme has also successfully brought down the annual parasite incidence (API) from 0.08 in 2015 to 0.06 in 2017. The success of malaria control programme relies on three main efforts: early diagnosis and prompt treatment, provision of long-lasting insecticidal bed nets (LLINs) and insecticide residual spraying. Attempts to develop a suitable vaccine to prevent malaria were so far fruitless as several vaccine candidates produced still fail to meet the required efficacy [2].

The clinical manifestation of malaria infection in human varies widely, from asymptomatic to fatal infections with cerebral or non-cerebral complications. This phenomenon is associated with factors associated with the malarial parasite, human host and environment. Studies to identify parasite factors that contribute to virulence revealed several candidates such as antimalarial drug resistance, cytoadherence, and antigenic polymorphisms [3]. Clinical manifestation of malaria is directly associated with the repeated cycle of invasion of the red blood cell (RBC) by merozoites, followed by development into schizont which end up in the rupture of the RBC and release of daughter merozoites. During the blood stage, the parasite expresses arrays of proteins and among others are merozoite surface protein 1 (MSP1) and MSP2. These proteins are involved in erythrocyte invasion [4] and are targeted by the immune responses [5, 6], and therefore have been used as target for vaccine development. The msp1 and msp2 genes also exhibit high polymorphisms hence play important role in identification of genetically distinct P. falciparum parasite sub-populations [4]. The msp1 gene is located on chromosome 9 and contains 17 blocks of sequences [7]; block 2 is most polymorphic and is grouped into three allelic families MAD20, K1 and RO33 [8]. The msp2 gene is located on chromosome 2 composed of 5 blocks and block 3 is the most polymorphic [9]. The msp1 alleles are grouped into two allelic families, FC27 and IC1/3D7) [10].

Many studies have explored the potential roles of msp1 and msp2 alleles in the modulation of malaria clinical manifestations. In French Guyana, study on the msp1 and var genes demonstrated that msp1 K1 allele and var genes, D allele overexpression associated with severe malaria [11]. Multiple field studies have tried to characterize virulent strain of P. falciparum using genetic polymorphisms as markers. Although evidence of differences in virulence among the P. falciparum strains have accumulated, the virulent strains have not yet been characterized in sufficient detail to identify suitable virulence markers. The present study aims to explore the allelic diversity of merozoite surface protein genes among the P. falciparum isolates in Aceh Province and their potential association with the severity of clinical manifestation of malaria.

Methods

Ethical statement

This study has been approved by the Medical and Health Research Ethic Committee, Faculty of Medicine Gajah Mada University, with reference No: KE/FK/173/EC. All subjects were asked for informed consent prior to participation.

Study site

This study was conducted in eleven district hospitals in Aceh Province, Indonesia (Fig. 1). Patients admitted with initials diagnosis of malaria were screened for cases with mono infection of P. falciparum without any co-morbidity (Fig. 2). At admission, thick and thin blood films were obtained using finger prick, stained with Giemsa and examined by accredited microscopists. Any subjects declared positive by microscopy will be further stated in parasite density per microlitre blood as previously described. Dried blood spots were made using 3MM Whatman 3 M paper (GE Healthcare, Buckinghamshire, UK) and kept in individual plastic ziplock until used.

Fig. 1
figure 1

Study sites in Aceh; Kota Banda Aceh, Sabang, Kota Lhokseumawe, Aceh Besar, Aceh Barat Daya, Nagan Raya, Aceh Barat, Aceh Jaya, Aceh Utara, Pidie Jaya, and Pidie

Fig. 2
figure 2

Study flowchart samples collection

Determination of malaria severity

Upon admission to the hospital, all subjects underwent physical examination and laboratory assays for complete blood count, thin and thick blood smear, liver and kidney function tests. History taking and consent were obtained from patients or legal guardian. Clinical manifestation of the patients was assessed and classified using the World Health Organization (WHO) criteria [12].

Criteria for severe malaria

Severe falciparum malaria is defined as one or more of the following [11], occurring in the absence of an identified alternative cause and in the presence of P. falciparum asexual parasitaemia: (a) impaired consciousness, (b) prostration, (c) multiple convulsions, (d) hypoglycaemia, (e) renal impairment, (f) jaundice, (g), pulmonary oedema and (h) significant bleeding, such as haematemesis or melaena.

DNA extraction and polymerase chain reaction

The parasite DNA was extracted from the filter paper using Chelex-100 ion exchanger method as described previously [13]. The DNA extract was used as template for the nested-1 PCR for determining species of the parasite [14] and only cases with monoinfection with P. falciparum will be enrolled. All enrolled subjects will be PCR amplified using oligos that target the parasite msp1 [M1-OF 5′- CTAGAAGCTTTAGAAGATGCAGTATTG -3′ and M1-OR 5′- CTTAAATAGTATTCTAATTCAAGTGGATCA -3′] and msp2 genes [M2-OF 5′- ATGAAGGTAATTAAAACATTGTCTATTATA -3′ and M2-OR 5′- CTTTGTTACCATCGGTACATTCTT -3′] with a total of 25 µl volume was used for all reactions [15]. Furthermore, primers for the second amplification reaction (Nested 2) were used following the procedure described previously: primer set targets specific allelic families of msp1 (MAD20, K1 and R033), and msp2 (IC/3D7 and FC27); K1 = F-5: AAA-TGA-AGA-AGA-AAT-TAC-TAC-AAA-AGG-TGC-3 and R-5: GCT-TGC-ATC-AGC-TGG-AGG-GCT-TGC-ACC-AGA-3; MAD20 = F-5: AAA-TGA-AGG-AAG-AAC-TGG-AAC-AGC-TGT-TG-3 and R-5: ATC-TGA-AGG-ATT-TGT-ACG-TCT-TGA-ATT-ACC-3; RO33 = F-5: TAA-AGG-ATG-GAG-CAA-ATA-CTC-AGT-TGT-TG-3 and F-5: CAT-CTG-AAG-TTG-GAT-CAG-CAC-CTG-GAG-ATC-3; 3D7 = F-5: AGA-AGT-ATG-GCA-GAA-AGT-AAK-CCT-YCT-ACT-3 and R-5: GAT-TGT-AAT-TCG-GGG-GAT-TCA-GTT-TGT-TCG-3; FC 27 F-5: ACT-AAG AAT-AGT-GTA-GGT-GCA-RAT-GCT-CCT-3 and R-5: TTT-TAT-TTG-GTG-CAT-TGC-CAG-AAC-TTG-AAC-3F [15]. The second reaction primer set targets specific allelic families of msp1 (MAD20, K1 and R033) or msp2 (IC/3D7 and FC27). Reactions for each set of primary and nested primers were performed separately.

Multiplicity of infection (MOI)

MOIs were calculated by dividing the total number of distinct msp1 and msp2 genotypes by the number of positive samples for each marker. The mean MOI was calculated by dividing the total number of alleles detected in both msp1 and msp2 by the total number of positive samples for both markers. Samples were considered single infected when harbouring only one allele at each of the genotyped loci. Multiclonal infections were defined as infections with more than one allele in at least one locus.

Statistical analysis

All data were collected with Epidata and analysed by R version 3.4.0. The allelic subfamily frequency of msp1 and msp2 was calculated as the proportion of the allele detected for each allelic family out of the total of alleles detected. The frequency of polyclonal infection was calculated using number of samples with more than one amplified fragment out of the total samples. The mean MOI was determined by dividing the total number of alleles detected in both msp1 and msp2 by the total number of positive samples for both markers. The Chi-square test was used to analyse the association of the clinical manifestations and the allelic subfamilies of the msp1 and msp2. Statistical significance was defined as p < 0.05.

Results

The study subject’s recruitment flowchart and the procedures applied to subjects is shown in Fig. 2. Of the total 500 subjects admitted to the hospitals with fever, 176 subjects (52 males and 38 females) were found positive by microscopy and 117 of which by P. falciparum. Further validation by PCR revealed 90 subjects with P. falciparum mono infection. Among the 90 study subjects, 57.7% of them were males and 42.3% were females with most subjects 46.7% aged between 21 and 30 years old (Table 1).

Table 1 Characteristics of study subjects Plasmodium falciparum malaria cases

Clinical manifestation of the subjects

The clinical manifestation, origin and laboratory profiles of each subjects is shown in Table 2. The commonly observed symptoms and signs includes fever with chill (100%), dyspnoea (75.6%) and spleen enlargement (87.8%). Severe signs such as shock, convulsion and conscious disturbance were observed in few cases. Laboratory assays revealed anaemia in 36.8% of the subjects, abnormalities in the values of liver (63%) and kidney (95.6%) function, and haemoglobinuria (20%). Of the 90 subjects examined 92% had parasite density of 10,000 parasites per microlitre blood and the remaining 8% had parasite density of less than 10,000/µl blood. The parasite density of the subjects ranged from 5000 to 15,000 parasites per microlitre blood. Based on WHO classification [12], 19 (21%) subjects were classified as severe malaria whereas the remaining 71 (79%) subjects were mild, uncomplicated malaria.

Table 2 Clinical manifestation and laboratory profiles in Aceh Province

Allelic subfamily frequency of the msp1 and msp2 genes

Allelic analysis of the msp1 gene revealed the existence of K1 (37.7%), MAD20 (46.7%), and RO33 (1.1%) subfamily, either as single or mixed allelic subfamilies. Mixed allelic subfamilies infections between K1 and MAD20, K1 and R033 and MAD20 with RO33 were also found in less frequency (Table 3). Analysis of the size of amplicons in each subfamily revealed that K1 subfamily had 3 alleles, MAD-20 had 5 alleles and RO33 had 2 alleles. Allelic analysis of the msp2 gene revealed that there were two different allelic subfamilies. Of the total 90 subjects examined, the FC27 subfamily was observed in 41.4%, the 3D7 subfamily in 37.7% of the subjects and 21.2% of the subjects carried the mixed subfamilies of FC27 and 3D7. Analysis of the size of amplicons in each msp2 subfamily revealed that FC27 had 4 alleles and 3D7 had 3 alleles (Table 3, Fig. 3).

Table 3 Allelic frequency of the msp1 and msp2 genes in Aceh
Fig. 3
figure 3

Electrophoregram of the msp1 and msp2 PCR are shown for the following pictures: a MAD20 (160–500 bp); b RO33 (130–220 bp); c K1 (160–350 bp); d 3D7 (100–450 bp); and e FC27 (250–530 bp)

Multiplicity of infection (MOI)

Of the total 90 subjects analysed for the allelic subfamilies of msp1 and msp2, 13 subjects (14.4%) were found to carry multiple allelic subfamilies infection of msp1, whereas for msp2, 19 subjects (21.1%) were found. The MOIs for both msp1 and msp2 were 2.27 and 2.69, respectively. The MOI for msp2 was slightly higher than msp1 (Table 3). However, the amplicons were not run in a high concentration agarose gel to confirm the size of the amplicons.

Association of clinical manifestation with the msp1 and msp2 alleles subfamilies

Analysis of msp1 and msp2 allelic subfamilies and each form of clinical manifestation and laboratory profiles revealed that abnormal liver function abnormal value was the only variable showing significant correlation with multiple allelic subfamilies of FC27 + 3D7 (OR: 0.13; 95%CI 0.03 to 0.53, p < 0.01). All others clinical manifestations showed no significant correlation with allelic subfamilies of msp1 and msp2 (p > 0.05) (Tables 4, 5). Based on the severity of clinical manifestation as classified by the WHO [11], subjects carried the mixed allelic subfamilies of K1 and RO33 of msp1 had higher chance to have severe malaria (OR: 28.50; 95%CI: 1.59–1532.30) (Table 6). Other alleles revealed either no association or insignificant p-value.

Table 4 Association between clinical manifestation and allelic subfamilies
Table 5 Association between clinical manifestation and msp2 allelic subfamilies
Table 6 Association of malaria severity with the msp1 and msp2 alleles

Discussion

Analysis of the clinical manifestation of the malaria cases admitted to the hospitals in Aceh revealed that the classical symptoms, such as fever with chill is still the primary symptom experienced by the patients, followed by spleen enlargement and dyspnoea. Majority of the malaria cases are classified as mild, uncomplicated malaria but over 20% of which are severe according to WHO criteria [12]. The findings are in accordance with the report of the Ministry of Health where malaria in many parts of Aceh continues to decrease, making the risk to having malaria also diminishing and affect mainly adults who stay or travel to remaining endemic foci in the Province or other parts of the country [15]. This situation is completely different with the malaria cases found in eastern parts of the country where children are still the most vulnerable group and adults are usually asymptomatic [16, 17].

Analysis of the MOI based on the allelic diversity of msp1 and msp2 revealed a value of 2.27 and 2.67 for the msp1 and msp2, respectively. This finding is slightly higher than the MOI data from Myanmar [18] and Southwest Pacific [19], but lower than Thailand, Kenya and Burkina Faso [20,21,22,23]. The difference in MOI can be attributed to several factors such as differences in geographical areas, intensity of malaria transmission, and difference in age of study population and mean parasite density in the study population [24,25,26]. In this study, all subjects are adult with symptomatic malaria and therefore with a relatively higher parasite density. Several studies reported conflicting results in which the MOI correlates with ages, parasite density [26, 27] and intensity of malaria transmission [28] but others studies failed to demonstrate this correlation [29, 30]. Low MOI reported in this study might also be attributed to the decreasing malaria transmission intensity in Aceh, following the implementation of the malaria elimination program in the area. It is of interest to note that despite a significant reduction of malaria in the area, a challenge of zoonotic malaria is currently increasing [31]. With regard to the parasite density, we did not observe any subjects with extremely high parasite density, such as parasite density > 100,000 per microlitre blood. This finding indicate that parasite density is not a contributing factor to specific clinical manifestation.

Analysis on the genetic diversity profiles of P. falciparum with the malaria clinical manifestation may provide useful information about parasite characteristics to design specific intervention strategies targeting the virulence factors [32] as well as to the evaluation of drug efficacy [33]. This study is the first study in Indonesia that provides information about genetic diversity of msp1 and msp2 alleles of P. falciparum among the hospitalized malaria cases. Analysis to determine the association between allelic subfamilies of the msp1 and msp2 with malaria severity revealed a strong association between mixed msp1 K1 + RO33 with severe malaria. The finding is slightly different with that of Ariey et al. [10] where K1 allele subfamily and the D allele of var gene overexpression associated with severe malaria. Other findings reported a high proportion of subjects carrying the FC27 allele subfamily among the uncomplicated malaria patients [34]. This difference might be associated with the multifactorial nature of severe malaria with diverse clinical manifestation [2]. The difference in geographic setting, age of the subjects, and genetic background of the parasites and host certainly contribute substantial role. This finding is in accordance with the findings in previous studies in Bobo-Dioulasso [35]. Another study has also investigated genetic diversity of P. falciparum isolates, which was conducted in Libreville, Gabon. In the study, extensive genetic polymorphism within msp1 allelic families (30 alleles identified) has been observed. This is consistent with the diversity found in Bakoumba (25 alleles) in 1999, Senegal (33 alleles) in 1995, and in Mauritania (27 alleles) in 2010 [36, 37]. This study on the distribution of msp2 allele subfamilies showed the presence of two allelic subtypes in the study area, which is similar to the results of study conducted by Kang et al. in Myanmar where the geographical areas are alike. Their study also found only two allelic subtypes in Myanmar, which are the FC27 and 3D7. The difference between their study and our study is that the number of patients infected by mixed allelic subtypes is higher than patients affected by single infections; while our study has demonstrated contrasted finding where single infection, either by FC27 or 3D7 alleles is higher [37, 38]. This study also evaluated each clinical manifestations and symptoms among patients with falciparum malaria in Aceh Province and found out association between liver function abnormal value with mixed allelic msp2 infection. This finding has never been analysed in previous studies except for the severe malarial anaemia [34]. Despite different results found, a closer observation on the phenotypes deserves further exploration in the other geographic areas. This study acknowledges several limitations such as the inadequate amount of sample size, difficulties to precisely estimate the allelic frequencies and genetic diversity due to the detection limit of the PCR technique used in the study. Alleles with short differences in length (less than 10 bp) might not be clearly distinguished.

Conclusion

Allelic subfamilies analysis of the msp1 and msp2 genes among the hospitalized uncomplicated and severe malaria cases in Aceh have been analysed. Association between liver function abnormal value with the mixed allelic type of msp2 was observed. Mixed allelic infection of msp1 K1 and RO33 is strongly associated with severe malaria. This study has several limitations such as analyzing symptomatic malaria cases and only few severe cases. Further study to explore more subjects in different geographic setting and different clinical manifestation is recommended.

Availability of data and materials

All relevant data are within the manuscript.

References

  1. Ministry of Health, Republic of Indonesia. Handbook of malaria treatment guidelines in Indonesia (Buku saku pedoman pengobatan malaria di Indonesia). 2017. https://persi.or.id/wp-content/uploads/2020/11/bukusaku_malaria.pdf

  2. WHO. Malaria vaccine. Wkly Epidemiol Rec. 2016;91:33–52.

    Google Scholar 

  3. Miller LH, Baruch DI, Marsh K, Doumbo OK. The pathogenic basis of malaria. Nature. 2002;415:673–9.

    Article  CAS  Google Scholar 

  4. Holder AA, Blackman MJ, Burghaus PA, Chappel JA, Ling IT, McCallum Deighton N, et al. A malaria merozoite surface protein (MSP1)-structure, processing and function. Mem Inst Oswaldo Cruz. 1992;87:37–42.

    Article  Google Scholar 

  5. Apio B, Nalunkuma A, Okello D, Riley E, Egwang TG. Human IgG subclass antibodies to the 19 kilodalton carboxy terminal fragment of Plasmodium falciparum merozoite surface protein 1 (MSP1(19)) and predominance of the MAD20 allelic type of MSP1 in Uganda. East Afr Med J. 2000;77:189–93.

    CAS  PubMed  Google Scholar 

  6. Woehlbier U, Epp C, Kauth CW, Lutz R, Long CA, Coulibaly B, et al. Analysis of antibodies directed against merozoite surface protein 1 of the human malaria parasite Plasmodium falciparum. Infect Immun. 2006;74:1313–22.

    Article  CAS  Google Scholar 

  7. Takala S, Branch O, Escalante AA, Kariuki S, Wootton J, Lal AA. Evidence for intragenic recombination in Plasmodium falciparum: identification of a novel allele family in block 2 of merozoite surface protein-1: Asembo Bay Area Cohort Project XIV. Mol Biochem Parasitol. 2002;125:163–71.

    Article  CAS  Google Scholar 

  8. Takala SL, Escalante AA, Branch OH, Kariuki S, Biswas S, Chaiyaroj SC. Genetic diversity in the Block 2 region of the merozoite surface protein 1 (MSP-1) of Plasmodium falciparum: additional complexity and selection and convergence in fragment size polymorphism. Infect Genet Evol. 2006;6:417–24.

    Article  CAS  Google Scholar 

  9. Ferreira MU, Hartl DL. Plasmodium falciparum: worldwide sequence diversity and evolution of the malaria vaccine candidate merozoite surface protein-2 (MSP-2). Exp Parasitol. 2007;115:32–40.

    Article  CAS  Google Scholar 

  10. Mohammed H, Mindaye T, Belayneh M, Kassa M, Assefa A, Tadesse M, et al. Genetic diversity of Plasmodium falciparum isolates based on MSP-1 and MSP-2 genes from Kolla-Shele area, Arbaminch Zuria District, southwest Ethiopia. Malar J. 2015;14:73.

    Article  Google Scholar 

  11. Ariey F, Hommel D, Le Scanf C, Duchemin JB, Peneau C, Hulin A. Association of severe malaria with a specific Plasmodium falciparum genotype in French Guiana. J Infect Dis. 2001;15:237–41.

    Article  Google Scholar 

  12. WHO. Guidelines for the treatment of malaria. 2nd ed. Geneva: World Health Organization; 2015.

    Google Scholar 

  13. Wooden J, Kyes S, Sibley CH. PCR and strain identification in Plasmodium falciparum. Parasitol Today. 1993;9:303–5.

    Article  CAS  Google Scholar 

  14. Singh B, Bobogare A, Cox-Singh J, Snounou G, Abdullah MS, Rahman HA. A genus- and species-specific nested polymerase chain reaction malaria detection assay for epidemiologic studies. Am J Trop Med Hyg. 1999;60:687–92.

    Article  CAS  Google Scholar 

  15. Snounou G, Färnert A. Genotyping of Plasmodium falciparum parasites by PCR: msp1, msp2, and glurp. In: Ljungström I, Perlmann H, Schlichtherle M, Scherf A, Wahlgren M, Eds. Methods in Malaria Research, 4th Edn. Malaria Research and Reference Reagent Resource Center (MR4), 2008;221–25.

  16. Asih PBS, Rozi IE, Herdiana, Pratama NR, Hidayati AP, Marantina SS, et al. The baseline distribution of malaria in the initial phase of elimination in Sabang Municipality, Aceh Province, Indonesia. Malar J. 2012;11:291.

    Article  Google Scholar 

  17. Syafruddin D, Chan, Asih P, Sekartuti, Dewi RM, Coutrier F, et al. Seasonal prevalence of malaria in West Sumba district. Indonesia Malar J. 2009;9:8.

    Article  Google Scholar 

  18. Syafruddin D, Bangs MJ, Sidik D, Elyazar I, Asih PBS, Chan K, et al. Impact of a spatial repellent on malaria incidence in two villages in Sumba. Indonesia Am J Trop Med Hyg. 2014;91:1079–87.

    Article  Google Scholar 

  19. Than NS, Wu Y, Tun MW, Xu X, Hu Y, Ruan Y, et al. Genetic diversity of Plasmodium falciparum populations in southeast and western Myanmar. Parasit Vectors. 2017;10:322.

    Article  Google Scholar 

  20. Cristian K, Waltmann A, Ome-Kaius M, Robinson LJ, Mueller I. Multiplicity of infection is a poor predictor of village-level Plasmodium vivax and P. falciparum population prevalence in the Southwest Pacific. Open Forum Infect Dis. 2018;5:ofy240.

    Article  Google Scholar 

  21. Abdoulie OT, Mobegi VA, Wamunyokoli F, Herren JK. Diversity and Multiplicity of P. falciparum infections among asymptomatic school children in Mbita, Western Kenya. Sci Rep. 2020;10:5924.

    Article  Google Scholar 

  22. Olasehinde GI, Yah CS, Singh R, Olusola OO, Ajayi AA, Valecha N, et al. Genetic diversity of Plasmodium falciparum field isolates from southwestern Nigeria. Afr Health Sci. 2012;12:3.

    Google Scholar 

  23. Tepanata P, Arnathau C, Durand P, Kanchanakhan N, Siripoon N, Suegorn A, et al. Genetic diversity and population structure of Plasmodium falciparum in Thailand, a low transmission country. Malar J. 2009;8:155.

    Article  Google Scholar 

  24. Kanungnit C, Sukaram R, Prompan Y, Dornae A. Genetic diversity of the msp-1, msp-2, and glurp genes of Plasmodium falciparum isolates along the Thai-Myanmar borders. Asian Pac J Trop Biomed. 2014;4:598–602.

    Article  Google Scholar 

  25. Issiaka S, Nébié I, Ouédraogo A, Gansane A, Diarra A, Tiono AB, et al. Plasmodium falciparum genotypes diversity in symptomatic malaria of children living in an urban and a rural setting in Burkina Faso. Malar J. 2009;8:135.

    Article  Google Scholar 

  26. Hamid MM, Mohammed SB, El Hassan IM. Genetic diversity of Plasmodium falciparum field isolates in Central Sudan inferred by PCR genotyping of merozoite surface protein 1 and 2. N Am J Med Sci. 2013;5:95–101.

    Article  Google Scholar 

  27. Konaté L, Zwetyenga J, Rogier C, Bischoff E, Fontenille D, Tall A, et al. Variation of Plasmodium falciparum msp1 block 2 and msp2 allele prevalence and of infection complexity in two neigh bouring Senegalese villages with different transmission conditions. Trans R Soc Trop Med Hyg. 1999;93:21–8.

    Article  Google Scholar 

  28. Vafa M, Troye-Blomberg M, Anchang J, Garcia A, Migot-Nabias F. Multiplicity of Plasmodium falciparum infection in asymptomatic children in Senegal: relation to transmission, age and erythrocyte variants. Malar J. 2008;7:17.

    Article  Google Scholar 

  29. Slater M, Kiggundu M, Dokomajilar C, Kamya MR, Bakyaita N, Talisuna A, et al. Distinguishing recrudescences from new infections in antimalarial clinical trials: major impact of interpretation of genotyping results on estimates of drug efficacy. Am J Trop Med Hyg. 2005;73:256–62.

    Article  CAS  Google Scholar 

  30. Bendixen M, Msangeni HA, Pedersen BV, Shayo D, Bodker R. Diversity of Plasmodium falciparum populations and complexity of infections in relation to transmission intensity and host age: a study from the Usambara Mountains, Tanzania. Trans R Soc Trop Med Hyg. 2001;95:143–8.

    Article  CAS  Google Scholar 

  31. Basco LK, Ringwald P. Molecular epidemiology of malaria in Yaounde, Cameroon. VIII. Multiple Plasmodium falciparum infections in symptomatic patients. Am J Trop Med Hyg. 2001;65:798–803.

    Article  CAS  Google Scholar 

  32. Issifou S, Ndjikou S, Sanni A, Lekoulou F, Ntoumi F. No influence of the transmission season on genetic diversity and complexity of infections in Plasmodium falciparum isolates from Benin. Afr J Med Med Sci. 2001;30:17–20.

    PubMed  Google Scholar 

  33. Coutrier FN, Tirta YK, Cotter C, Zarlinda I, González IJ, Schwartz A, et al. Laboratory challenges of Plasmodium species identification in Aceh Province, Indonesia, a malaria elimination setting with newly discovered P. knowlesi. PLoS Negl Trop Dis. 2018;12:e0006924.

    Article  Google Scholar 

  34. Snounou G, Viriyakosol S, Jarra W, Thaithong S, Brown KN. Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Mol Biochem Parasitol. 1993;58:283–92.

    Article  CAS  Google Scholar 

  35. Ishraga EA, El Ghazali G, A-Elgadir TME, Hamad AA, Babiker HA, Elbashir MI, et al. Allelic polymorphism of MSP2 gene in severe P. falciparum malaria in an area of low and seasonal transmission. Parasitol Res. 2007;102:29–34.

    Article  Google Scholar 

  36. Bazié T, Zongo I, Yerbanga RS, Nikiéma F, Neya C, Taho LK, et al. Plasmodium falciparum msp1 and msp2 genetic diversity and allele frequencies in parasites isolated from symptomatic malaria patients in Bobo-Dioulasso, Burkina Faso. Parasit Vectors. 2018;11:323.

    Article  Google Scholar 

  37. Durand R, Ariey F, Cojean S, Fontanet A, Ranaivo L, Ranarivelo LA, et al. Analysis of circulating populations of Plasmodium falciparum in mild and severe malaria in two different epidemiological patterns in Madagascar. Trop Med Int Health. 2008;13:1392–9.

    Article  Google Scholar 

  38. Amodu OK, Oyedeji SI, Ntoumi F, Orimadegun AE, Gbadegesin RA, Olumese PE, et al. Complexity of the msp2 locus and the severity of childhood malaria, in south-western Nigeria. Ann Trop Med Parasitol. 2008;102:95–110.

    Article  CAS  Google Scholar 

Download references

Acknowledgements

The authors are grateful to individuals who participated in this study. The authors wish to thank staffs from the Faculty of Medicine Syiah Kuala University Aceh, Eijkman Institute for Molecular Biology Jakarta, professional staffs at Aceh Provincial Health Department, District Health Department Kota Banda Aceh, Sabang, Kota Lhokseumawe, Aceh Besar, Aceh Barat Daya, Nagan Raya, Aceh Barat, Aceh Jaya, Aceh Utara, Pidie Jaya, and Pidie, for the support, encouragement and helping for samples collection. Ferdyan Fuad helping for administration in study. This study is part of a KFJ dissertation for doctorate program at the Gajah Mada University.

Funding

Samples collection in Aceh were supported by Research Grant from The Ministry of Research and Technology, Republic of Indonesia, through Faculty of Medicine, Syiah Kuala University. Molecular analysis was also supported by The Ministry of Research and Technology, Republic of Indonesia, through Eijkman Institute for Molecular Biology.

Author information

Authors and Affiliations

Authors

Contributions

KFJ, HH, MRK, and TMZ performed samples collection and data analysis. KFZ, NRP, SSM, JH, IER, PBSA, and DS molecular assays, data analysis, and manuscript writing. KFJ, S and DS designed the study and responsible for management and fund raising for this study. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Kurnia Fitri Jamil.

Ethics declarations

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no conflict of interest.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Jamil, K.F., Pratama, N.R., Marantina, S.S. et al. Allelic diversity of merozoite surface protein genes (msp1 and msp2) and clinical manifestations of Plasmodium falciparum malaria cases in Aceh, Indonesia. Malar J 20, 182 (2021). https://0-doi-org.brum.beds.ac.uk/10.1186/s12936-021-03719-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12936-021-03719-w

Keywords