Plasmodium falciparum isolates from southern Ghana exhibit polymorphisms in the SERCA-type PfATPase6 though sensitive to artesunate in vitro

Table 1 Oligonucleotide primers and PCR reaction conditions for SNPs detection in pfATPase6, pftctp, pfmdr 1 and pfcrt genes

Gene Primer pair	Sequence 5' ⇒ 3'	PCR product size (bp)	PCR reaction conditions
*pfATPase6*
atp6-1F	tcatctaccgctattgtatgtgg	777	94^oC 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 40''); 72°C 5'
atp6-1R	attcctcttagcaccactcct
atp6-2F	tcaccaaggggtatcaacaa	692	94°C 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 40''); 72°C 5'
atp6-2R	tggcataatctaattgctcttcc
atp6-3F	atgtatagctgttgtaatcaacctaga	822	94°C 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 40'); 72°C 5'
atp6-3R	tcactatatggatcagcttcatca
atp6-4F	ccagtacattgaatgaaaatg	605	94°C 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 40''); 72°C 5'
atp6-4R	acgtggtggatcaataatacct
*pftctp*
pftctp-1F	atgaaagtatttaaagacgtt	462	94°C 5' followed by 40 cycles (94°C 15'';
pftctp-1R	ttcttctcctttataataagaat		50°C 30''; 72°C 40''); 72°C 5'
*pfmdr1*
mdr1-1F	tgaacaaaaagagtaccgctga	823	94°C 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 1'); 72°C 5'
mdr1-1R	ccataccaaaaaccgaatgc
mdr1-2F	caagcggagtttttgcattt	1062	94°C 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 1'); 72°C 5'
mdr1-2R	ttctctgtttttgtccacctga
*pfcrt*
pfcrt-1'F	atggctcacgtttaggtgga		94°C 5' followed by 40 cycles (94°C 15''; 55°C 15''; 72°C 40''); 72°C 2'
pfcrt-2R	aaagcttcggtgtcgttc
pfcrt-1F	tgtgctcatgtgtttaaactt		94°C 5' followed by 25 cycles (94°C 15''; 48°C 30''; 72°C 20''); 72°C 5'
pfcrt-2'R	ggaatagattctcttataaatcc	282

The oligonucleotide primers were supplied by Greiner Bio-One Co., Ltd. Primer pairings of pfATPase6 gene, 1F & 1R, 2F & 2R, 3F & 3R, 4F & 4R were used resulting in the corresponding PCR product sizes. For the pfcrt primers, nested PCR was carried out with 1'F & 2R in the first reaction, followed by 1F & 2'R in the second reaction.

ISSN: 1475-2875